Articles

 

Articles

Page 4 of 1131, showing 50 records out of 56511 total, starting on record 151, ending on 200

July 2018

African Journal of Plant Science
Effect of substrate media on growth, yield and nutritional composition of domestically grown oyster mushroom (Pleurotus ostreatus)

The effect of substrate (medium) on growth, yield and nutritional composition of domestically-grown oyster mushroom (Pleurotus ostreatus) was investigated. Six different substrates namely sawdust only (SDO), sawdust + corn waste + CaCO3 (SDW), sawdust + rice bran + CaCO3 (SDR), sawdust + banana leaves (SBL), sawdust + cassava peel (SDC) and cassava peel only (CPO) were used.  The substrates were pasteurized with...

Author(s): Onyeka, E. U. and Okehie, M. A.

July 2018

International Journal of Educational Administration and Policy Studies
Universal basic education (UBE) policy implementation challenges: The dilemma of junior secondary schools administrators in Nigeria

The study examined the challenges hindering implementation of the universal basic educational (UBE) policy in Nigeria. The study is a descriptive survey research. The population of the study comprised all the two hundred and twenty one principals in Ebonyi state public junior secondary schools. Proportionate stratified random sampling technique was used to select 100 principals for the study. Instrument used for data...

Author(s): Aja S. N., Egwu S. O., Aja-Okorie U., Ani T. and Amuta N. C.  

July 2018

International Journal of Vocational and Technical Education
Implementation of mechanical engineering curriculum in school and industry in the 3 and 4 years vocational high school programs (VHS) for the improvement of the quality of graduates to meet the requirement of ASEAN economic community

In field application, there are various models of Vocational High School (VHS) education based on the period of study, education design in school or industry and competence design. There are 3 year VHS programme, 4 year VHS programme and community college. Vocational education in Indonesia challenges the Asean Economic Community. The appropriate vocational education curriculum either 3 year or 4 year VHS program is...

Author(s): Amiruddin, Djoko Kustono, Syamsul Hadi, Djuanda, Nurlaela Latief, Moch Bruri Triyono and Soetyono Iskandar  

July 2018

International Journal of Fisheries and Aquaculture
Observations on the biology of Nile tilapia, Oreochromis niloticus L., in Tekeze Reservoir, Northern Ethiopia

The study was done to examine some aspects of the reproductive biology of Nile tilapia (Oreochromis niloticus) in Tekeze Reservoir a newly man made hydropower reservoir. A total number of 1826 specimens of Nile Tilapia (O. niloticus) were collected from the reservoir from July 2015 to June 2016. Size at first maturity, sex ratio, gonado-somatic index (GSI), breeding season and fecundity were studied. The overall...

Author(s): Tsegay Teame, Haftom Zebib and Tesfay Meresa  

July 2018

International Journal of Sociology and Anthropology
Anthropometric measurements for young males in Saudi Arabia

The purpose of this study was to fill the gap of not having enough anthropometric data for young males in Saudi Arabia. Developing an anthropometric database on Saudi adults will help the local designers, manufactures and producers to create more efficient industrial applications, and products for Saudi population. The study was performed in the Riyadh city, the capital and the largest city in Saudi Arabia, among a...

Author(s): Waleed Basuliman

July 2018

International Journal of Sociology and Anthropology
Ethiopia’s health extension program: Opportunities and challenges of its implementation in Shiromeda

This study assesses the opportunities and challenges of implementing health extension program in Shiromeda Health Center, Addis Ababa, Ethiopia. It has three key objectives: to examine prospective and retrospective views of health extension workers towards health extension program; determine the challenges faced by clients in their health service utilization and examine the challenges extension workers face during...

Author(s): Dessalegn Mekuriaw Hailu  

July 2018

Journal of Stored Products and Postharvest Research
Influence of postharvest treatments on the proximate composition and sugar contents of fresh maize

Freshly harvested maize is highly perishable and it rapidly losses its sweetness within 3 days of harvest. This study investigated the influence of steeping on the proximate composition and sugar content of fresh maize stored at tropical ambient conditions (28 ± 2°C and 70% RH). The solutions used for steeping were salt (8%), sugar (10%), combination of the salt-sugar solution (2:3 v/v) while the control had...

Author(s): Isaac Babatunde Oluwalana, Matthew Kolawole Bolade, Olusola Samuel Jolayemi, Olumuyiwa Adekanmi Babarinsa, Olumuyiwa Abidemi Jeje and Toyin Paulina Ojo  

July 2018

International Journal of Nutrition and Metabolism
Wearable nutrition and dietetics technology on health nutrition paradigm shift in low and middle income countries

Real-time, effective and affordable nutrition and dietetics wearable technology and sensors are emerging field with immense opportunities and benefits to the global nutrition challenge. As a powerful public health nutrition game changer, it requires more research and development support in tackling food security and nutrition safety challenges and evidence in local and global priorities needs worldwide. Such revolution...

Author(s): Ernest Tambo, and Jeanne Yonkeu Ngogang,  

July 2018

African Journal of Cellular Pathology
Comparative study of the effects of aqueous and ethanol fruit extracts of Phoenix dactylifera L. on the cerebellar cortex of Artesunate–Amodiaquine treated adult Wistar rats

This study was to evaluate the effects of aqueous and ethanol fruit extracts of Phoenix dactylifera on the cerebellar cortex of Artesunate-Amodiaquine (AS–AQ) treated Wistar rats. Thirty-six adult male Wistar rats were randomly divided into nine groups (n=4). Group 1 served as the control; Group 2 received 2.86/8.75 mg/kg AS–AQ. Group 3 received 2.86/8.75 mg/kg AS–AQ + 100 mg/kg ascorbic acid; Groups...

Author(s): M. N. Budaye, S. S. Adebisi, A. A. Buraimoh, S. S. Lazarus and A. N. Agbon  

July 2018

International Journal of Peace and Development Studies
Remedying the retreat in the protection of citizens’ international human rights

The article argues that in the light of the many continuing gross abuses of international human rights perpetrated in many parts of the world and the growing disillusionment with the international human rights regime as a whole, the regime needs comprehensive reassessment.  It is argued that the underlying cause of this situation is the disunity of the present global system and its competing systems of...

Author(s): Graham Nicholson

July 2018

African Journal of Cellular Pathology
Phenotypic detection of multidrug resistant extended-spectrum beta-lactamase (ESBL) producing Escherichia coli from clinical samples

A clinico-laboratory investigation of multidrug resistant (MDR) characteristics of extended spectrum β-lactamase (ESBL) producing Escherichia coli pathotypes from some hospitals in Bauchi metropolis, Nigeria, was carried out. A total of 198 E. coli isolates were recovered from different patients’ age group (0 to above 70 years), comprising of 134 males and 85 females, as both out-patient (126) and in-patient...

Author(s): Iliyasu M. Y., Uba A. and Agbo E. B.  

July 2018

Journal of Toxicology and Environmental Health Sciences
The amelorative effect of L-arginin and omega-3 fatty acid against sodium valproate induced hepatotoxicity

Sodium valproate (VPA) used in epilepsy and has hepatotoxic effect in mammals. This work is to assess the role of L-arginin and omega-3 fatty acid against VPA oxidative stress on liver. This study was carried out on 70 rats divided into 7 groups each of 10 rats treated orally once daily 6days/ week; Group I (control), Group II ( L-arginin): each rat was received 300 mg/kg L-arginin, Group III (omega-3): each rat...

Author(s): Dalia M. Amin, Marwa T. Abaza, Walaa M. Sarhaan, Amany I. Ahmed, Amr A. Moustafa  

July 2018

Journal of Bioinformatics and Sequence Analysis
Evaluating the computing efficiencies (specificity and sensitivity) of graphics processing unit (GPU)-accelerated DNA sequence alignment tools against central processing unit (CPU) alignment tool

Bioinformatics is an emerging field, where information technology usage can significantly accelerate life science research. It is a relatively new field and the scope of exploring new tools and techniques seems immense. One major field where bioinformatics plays important role is next generation sequence analysis (NGS), in which an unknown genome is shuttered into pieces and tried to align it to a reference known genome...

Author(s): Shrikant Pawar, Aditya Stanam and Ying Zhu  

July 2018

Journal of Accounting and Taxation
Modeling an Analytic Hierarchy Process (AHP) assessment system for municipalities in Greece with public accounting of austerity

The new form of local government organization should be competent and effective in order to provide 21st century services equivalent to the citizens of every country. Its new developmental role can be fulfilled by implementing management techniques that will be conducive to local development. The use of accounting ratios from financial statements is necessary to municipalities as well as to every accounting body to...

Author(s): Panagiotis Pantelidis, Michail Pazarskis, Athanasia Karakitsiou and Vaia Dolka

July 2018

Journal of Ecology and The Natural Environment
Population status, feeding ecology and activity pattern of common bushbuck (Tragelaphus Scriptus decula) in Sekele Mariam Forest, West Gojjam, Ethiopia

A study on the population status, feeding ecology and activity pattern of common bushbuck (Tragelaphus scriptus decula) was carried out in the Sekele Mariam Forest from December 2016 to August 2017 including wet and dry seasons. Data were collected using total count and direct observation method. The collected data was analyzed using descriptive statistics and compared with Chi-square test and one way ANOVA. Average...

Author(s): Wubie Bayih and Mesele Yihune  

July 2018

International Journal of Physical Sciences
Mineralogical and geochemical properties of clay deposits in parts of Southeastern Nigeria

The rocks underlying many parts of Southeastern Nigeria had undergone extensive alterations to form considerable clay deposits. The mineralogical compositions of some of these clay deposits were evaluated with the X-Ray Diffraction (XRD) method to ascertain the suitability of the deposits as raw materials. Results of the analyses indicated that kaolinite (Al2Si2O5 (OH)4) is the dominant clay mineral. Traces of bentonite...

Author(s): Onyekuru S. O., Iwuoha P. O., Iwuagwu C. J., Nwozor K. K. and Opara K. D.  

July 2018

African Journal of Business Management
Modelling the relationship between innovation, strategy, strategic human resource management and organisation competitiveness

Several studies have been conducted to establish the link between strategy, human resource management (HRM) practices and organisation performance, yet no study has explored the alignment between strategy, innovation, strategic HRM and their impacts on organisation competitiveness. Therefore, the present study sets out to align strategy, innovation, strategic human resource management (SHRM) and organisation...

Author(s): J. E. Agolla  

July 2018

African Journal of Business Management
Pathways to the poor in Swaziland: What is the nature of micro insurance channels and distribution strategy?

When distribution is neglected, micro insurance fails. This considered, the objective of this study was twofold – to explore the nature of micro insurance distribution channels and to understand the distribution strategy of a commercial insurance company in Swaziland. Using interviews with the senior managers of a commercial insurer and its distribution partners, this study generated in-depth qualitative data on...

Author(s): M. Kanyangale and M. Lukhele  

July 2018

African Journal of Business Management
Untangling the concept of entrepreneurship towards a common perspective

There continues to be a lack of a commonly agreed perspective of entrepreneurship despite the concept being studied for a long period of time. Definitions of the concept and constructs of study in the field have depended on the researcher’s conceptualisation of what constitutes entrepreneurship and as a result there are variations in the study focus and measurement of entrepreneurship. An analysis of literature...

Author(s): Charles Mwatsika, Patrick Kambewa and Levison Chiwaula  

July 2018

African Journal of Microbiology Research
Biofertilising, plant-stimulating and biocontrol potentials of maize plant growth promoting rhizobacteria isolated in central and northern Benin

Plants constantly interact with a multitude of microorganisms that they select among other things through their roots. Some bacteria, known as plant growth promoting rhizobacteria (PGPR), are able to stimulate growth and control plant diseases, thanks to the expression of a wide range of beneficial properties to the plant. The aim of this work was to search for biofertilizing, plant-stimulating and biocontrol potentials...

Author(s): Nadège Adoukè Agbodjato, Olaréwadjou Amogou, Pacôme Agossou Noumavo, Gustave Dagbénonbakin, Hafiz Adio Salami,  Rachidath Karimou, Abdel-Madjid Alladé, Oyedele Adedayo, Farid Baba-Moussa, Adolphe Adjanohoun  and Lamine Saïd Baba-Moussa  

July 2018

African Journal of Microbiology Research
Antimicrobial resistance patterns of Enterobacteriaceae recovered from wastewater, sludge and dumpsite environments in Kakamega town, Kenya

Enteric bacterial resistance to antibiotics and the emergence of resistant pathogens in the environment is a global threat to public health. In Kenya, sewage treatment plants are not designed to eliminate enteric microbes, whereas domestic, medical and other hazardous wastes are all discarded in common solid-waste dump sites. Arising from these practices, waste treatment sites in developing countries may be important...

Author(s): Clarice Malaho, Sifuna Anthony Wawire, and William A. Shivoga,  

July 2018

African Journal of Agricultural Research
“Climate change perception and adaptation strategy associated with farming techniques in Tamou district wester Niger” farmers

The variability of climate parameters in most of agricultural areas in Niger represents a major risk for farmers. This work is aimed at analyzing farmer’s perception and adaptation to climate change parameters in Tamou district. The study was conducted on seventy three (73) millet farmers from seven villages in Tamou, namely Allambaré, Bani Guiti, Guieme, Tollondi , Moli Haoussa and Welgorou. The sample was...

Author(s): Mamane Baragé, Baragé Moussa and Jacques Comby  

July 2018

African Journal of Agricultural Research
Cowpea response to nutrient application in Burkina Faso and Niger

Cowpea (Vigna unguiculata (L.) Walp) is important in semi-arid West Africa. Yields are low due to inadequate water and nutrient availability and other constraints. Grain and fodder yield responses to nutrient application were determined from 21 site-years of research conducted in the Sahel and Sudan Savanna. The incomplete factorial treatment arrangement varied by country but included: Four levels each of P and K in 7.5...

Author(s): Idriss Serme, Nouri Maman, Maman Garba, Abdoul Gonda, Korodjouma Ouattara, and Charles Wortmann  

July 2018

African Journal of Agricultural Research
Cultivation of watermelons submitted to water deficit in the experimental area of Brazilian semiarid

The culture of watermelon is mostly responds to technological advancement. The fruit is analyzed in terms of its production and quality. Among the factors involved in its production, irrigation is very important; however it must be well managed. There are phases of the culture that requires greater or lesser amount of water for maximum productivity and high quality. In this context, the present research was conducted to...

Author(s): N. N. Veras, V. L. A. Lima, M. Valnir, J. Suassuna and V. F. Silva  

July 2018

African Journal of Agricultural Research
Humic acids and brassinosteroid application effects on pineapple plantlet growth and nutrition during the aclimatization phase

Humic acid and brassinosteroid applications may be an alternative to decrease the pineapple plantlet acclimatization in in vitro cultivation, since promising results have been observed when these substances were independently applied in other propagation methods. In this sense, the aim of the present study was to evaluate the effects of humic acids and brassinosteroid application on 'BRS Vitória'...

Author(s): Paulo Cesar dos Santos, Almy Junior Cordeiro de Carvalho, Mírian Peixoto Soares da Silva, Diego Alves Peçanha, Aurilena de Aviz Silva, Tiago Massi Ferraz and Marta Simone Mendonça Freitas  

July 2018

Journal of Medicinal Plants Research
Medicinal plants used in the treatment of livestock diseases in Berbere district of Bale zone, Oromia region, Ethiopia

An ethnoveterinary study of medicinal plants used by local people of Berbere district was carried out from June 25 to September 5, 2015. The study was focused on utilization of medicinal plants to treat various livestock health problems by people of the study area. The data were gathered using semi-structured interview, participant observation and personal interviews. A total of 69 informants (55 male and 14 female) in...

Author(s): Tilahun Tolossa Jima  

July 2018

Journal of Medicinal Plants Research
Plants and their metabolites against Streptococcus mutans

Oral diseases represent a major public health problem, especially for economically marginalized communities with limited access to health services. In addition, the constant increase in bacterial resistance to many of the antibiotics contributes to worsen the problem. In this context, great importance had been given to natural compounds for the discovery of new drugs that contribute to the prevention and control of oral...

Author(s): Landi B. O., Di Pace B. and Conceição A. O.  

July 2018

Journal of Medicinal Plants Research
Quantitative analyses of phytochemical and trace elements contents of daily detox, herbal tea consumed in Nigeria

Tea is one of the commonest drinks in most homes. Many people consume tea due to its unique taste and associated health benefits. Several medical disorders such as cancer, cardiovascular diseases and diabetes mellitus have been linked to the excessive generation of free radicals and oxidative stress. Studies conducted on Daily Detox, a tea consumed by many Nigerians have been limited to qualitative assessment of...

Author(s): Orimadegun B. E., Bolajoko E. B., Onyeaghala A. A. and Ademola-Aremu O. O.  

July 2018

African Journal of Biotechnology
Biotransformation of the residual liquid from the wet coffee benefit by Kluyveromyces marxianus

The search for biotechnological alternatives for the use of residuals generated in the agro-industrial processing of coffee is a current problem. This study evaluated the biotransformation of the liquid residual of the humid coffee benefit using the yeast Kluyveromyces marxianus CCEBI 2011. It was demonstrated that this strain is able to effectively use the reducing and neutral sugars in 24 h, for a yield of 40% in the...

Author(s): Cassamo Ussemane Mussagy, Kodjovi Kekeli Agbozouhoue and Manuel Serrat-Díaz  

July 2018

African Journal of Biotechnology
Evaluation of Curcuma zerumbet (Zingibaraceae) rhizome extracts sub-acute toxicity on Wistar rats

Plant extracts have been lately used by the population to treat various types of diseases, and this has been notably encouraged by the World Health Organization (WHO). Curcuma zerumbet (Zingiberaceae) belonging to the family of the Zingiberaceae, is herbaceous, perennial and, utilized by the population to treat gastric disorders. However, data on the subacute toxicity of this species are scarce in the literature....

Author(s): Márcia Seixas de Castro, Carlos Cleomir de Souza Pinheiro, Helyde Albuquerque Marinho and Amadis Batista Francisco  

July 2018

African Journal of Biotechnology
Biosurfactant production by Bacillus subtilis UFPEDA 86 using papaya (Carica papaya L.) waste as substrate: Viability studies and pH influence of the culture medium

Biosurfactants are surface-active compounds derived from microorganisms and offer several advantages over chemical surfactants, such as low toxicity, good biodegradability and ecological acceptability. Even though interest in biosurfactants is increasing, these bioproducts do not compete economically with synthetic surfactants due to the overall costs of the bioprocess. The use of inexpensive raw materials is an...

Author(s): Camylla Carneiro Soares, Adrielly Silva Albuquerque de Andrade, Gabriela Fontes Deiró Ferreira, Almeida Andrea Fraias de, Janice Izabel Druzian and Ana Katerine de Carvalho Lima Lobato,  

July 2018

Educational Research and Reviews
Commenting on effective laboratory teaching in selected preparatory schools, North Shewa Zone, Ethiopia

The present study assessed the challenges to implement laboratory teaching in selected Preparatory Schools, North Shewa Zone. The result of this study showed that although laboratories for each subjects were present (100%) in all districts, lack of professional skills (50% in biology, 64.5% in chemistry and 61.5% physics), lack of materials (78.6% in biology, 64.7% in chemistry and 65.4% in physics) and lack of...

Author(s): Andinet Nigussie, Said Mohammed, Endris Yimam, Worku Wolde, Negasi Akalu, Abubekir Seid, Genene Shiferaw, Tesfaye Teka and Solomon Mulaw  

July 2018

Educational Research and Reviews
Pedagogical development level of pre-service primary school teachers for science teaching

In this study, the pedagogical development level of pre-service primary school teachers for science teaching was examined. The participants of the study consist of 135 pre-service teachers from Primary School Teaching Department in Faculty of Education at Pamukkale University. After removing the invalid forms, a total of 128 pre-service teachers participated in the study. Data were collected with “Pre-service...

Author(s): Ümran Şahin  

July 2018

Educational Research and Reviews
Analysis of preschool curriculum in East Gojjam Zone: Implication to quality early childhood education

Developmentally appropriate curriculum is a component for quality early childhood care and education. This study was conducted in Debre Markos town, East Gojjam Zone, Ethiopia. The study aimed to evaluate if the textbooks implemented by private preschools are developmentally appropriate or not. Qualitative case study approach was employed and Mathematics and Environmental Science textbooks for upper kindergarten class...

Author(s): Wohabie Birhan  

July 2018

Educational Research and Reviews
Explaining the requirements for teacher’s development based on professional competencies approach

As teacher competencies and skills play a major role in their performance and thus the achievement of school and educational goals, teachers need to equip themselves with a variety of competencies to educate children who are potentially future leaders of the community. In this context, the present study aimed to find the correlation between each of the main dimensions of professional competencies and the main components...

Author(s): Leila Moghtadaie and Maryam Taji  

July 2018

African Journal of Pharmacy and Pharmacology
Assessment of antimalarial activity and proteomics analysis of Dioscorea membranacea Pierre.

Multidrug resistance Plasmodium falciparum remains a significant global health problem worldwide. New alternative antimalarial drugs are urgently needed. Dioscorea membranacea Pierre. is a Thai-medicinal plant that has been shown to exhibit a wide range of pharmacological activities. The study aimed to investigate antimalarial activity and possible protein targets of action of the crude ethanolic extract of the rhizome...

Author(s): Phunuch Muhamad, Luxana Panrit, Artitiya Thiengsusuk, Wanna Chaijaroenkul and Kesara Na-Bangchang  

July 2018

African Journal of Pharmacy and Pharmacology
Ethnomedicinal plants used for the treatment of gastro-intestinal parasitic diseases in human in Yeki district, Southwest Ethiopia

The use of medicinal plants plays a major role in the primary health care of human beings in Ethiopia. A study was carried out to document ethnomedicinal plants used for the treatment of gastrointestinal parasitic diseases of human in Yeki district, southwest Ethiopia. The key informants were selected using purposive sampling method. The information was obtained from 26 informants and 8 herbalists through the use of a...

Author(s): Belachew Garedew and Dagne Abebe  

July 2018

African Journal of Microbiology Research
Study on prevalence and genetic discrimination of methicillin-resistant Staphylococcus aureus (MRSA) in Egyptian hospitals

Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. The highest proportions of MRSA are reported by Jordan, Egypt and Cyprus investigators, where more than 50% of the invasive isolates are methicillin-resistant. The aim of this work was to study the prevalence, antibiotic sensitivity and genetic discrimination of MRSA in Egypt. Microbiological identification was done...

Author(s): Rana Elshimy, Rania Abdelmonem Khattab, Hamdallah Zedan, Alaa El-Din Shawky Hosny and Tarek H. Elmorsy  

July 2018

African Journal of Microbiology Research
Paediatric tuberculosis in a low burden setting of Saudi Arabia: Drug and multidrug resistance patterns

In this study, the infection of young children with Mycobacterium tuberculosis and drug-resistant M. tuberculosis in a mass gathering area in Al-Madinah Al-Munawwarah, was investigated and discussed. All the children, 15 years old and younger, who were referred to the central tuberculosis laboratory in Al-Madinah between January 2012 and December 2014 were included in this study. Among a total of 622 registered new...

Author(s): Mogahid M. Elhassan, Miskelyemen A. Elmekki, Hani A. Ozbak, Hassan A. Hemeg, Khalid A. Turkistani, Shamsoon K. Kafi and Ahmed A. Abdul-Aziz

July 2018

African Journal of Microbiology Research
Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens

Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591,...

Author(s): Jayanta Bhaduri, Pritam Kundu and Subhash Kanti Roy  

July 2018

African Journal of Agricultural Research
Thorn apple (Datura stramonium L.) allelopathy on cowpeas (Vigna unguiculata L.) and wheat (Triticum aestivum L.) in Zimbabwe

Datura stramonium extracts have allelopathic properties. The study was conducted to investigate the allelopathic effects of D. stramonium weed on seed germination, early seedling growth and dry biomass of crop plants (Triticum aestivum and Vigna unguiculata). Laboratory and greenhouse trials were arranged as completely randomised design and the field pot experiment was arranged as a randomised complete block design....

Author(s): Nyasha Sakadzo, Pahla Innocent, Muzemu Simbarashe, Mandumbu Ronald and Makaza Kasirayi  

July 2018

African Journal of Agricultural Research
Analysis of coffee quality along the coffee value chain in Jimma zone, Ethiopia

This study assesses the effect of cooperative, certification, private trader, farmers, sorting and processing methods on Arabica coffee quality. Coffee samples were collected from certified cooperatives, non-certified cooperatives, private traders and farmers (members of certified cooperatives, non-certified cooperatives and non-members of cooperatives). The study showed that coffee beans sampled from cooperatives had...

Author(s): Kassaye Tolessa, Luc Duchateau and Pascal Boeckx  

July 2018

African Journal of Agricultural Research
Sensor-based algorithms to improve barley nitrogen efficiency in Queensland

The low efficiency of nitrogen (N) fertilizers impels the innovation of current N management strategies in cereal production. Site specific N management is an emerging field providing novel alternatives to current nutrient management practices through canopy sensing. Barley N use efficiency can be enhanced with GreenSeeker proximal sensors, whose optimal utilization requires algorithms. The design of such algorithms...

Author(s): Paul Theophile Epee Misse, and Madan Gupta  

July 2018

African Journal of Agricultural Research
Screening of cowpea (Vigna unguiculata (L.) Walp.) lines for resistance to three Aphids (Aphis craccivora Koch) strains in Burkina Faso

Cowpea (Vigna unguiculata L. Walp.) is an important cash, food and nutritional security grain legume crop in the semi-arid regions of sub-Saharan Africa. However, its productivity is hampered by several biotic stress factors including numerous insect pests that infest and damage the crop at all its development stages in the field as well as during storage. This study sought to identify new sources of resistance to...

Author(s): Adelaїde P. Ouédraogo, Benoit J. Batieno, Fousseni Traore, Jean-Baptiste Tignegre, Bao-Lam Huynh, Philip A. Roberts, Timothy Close and Jeremy T. Ouédraogo  

July 2018

African Journal of Biotechnology
Rapid and efficient plant regeneration from shoot apical meristems of finger millet [Eleusine coracana (L.) Gaertn.] via direct organogenesis

A simple and efficient plant regeneration system via direct organogenesis was established in finger millet using in vitro derived shoot apical meristems. Six varieties; GBK-043128, GBK-043094, GBK-043050, GBK-043137, GBK-043122 and GBK-043124 were evaluated. MS medium was used for cotyledonary germination. Maximum number of shoots (84.33%) was observed in variety GBK-043128 while GBK-043094 had the least germination...

Author(s): Asunta Mukami, Alex Ngetich, Cecilia Mweu, Mutemi Muthangya, Richard O. Oduor, Mathew Ngugi and Wilton Mbinda  

July 2018

African Journal of Biotechnology
Assessment of morphological characteristics among upland rice (Oryza sativa and Oryza glaberrima) germplasm

Rice is an important staple food crop that feeds over half of the global population and has become the cereal that provides a major source of calories for the urban and rural poor in Africa. This work aimed to evaluate the morphological of rice (Oryza sativa and Oryza glaberrima) germplasm. In the present study, 14 quantitative traits were used across 48 accessions or genotypes obtained from Central Agricultural...

Author(s): Zogbo Luther, Richard Akromah, David P. Tokpah and Zipporah Page  

July 2018

International Journal of Physical Sciences
Theoretical models for prediction of methane production from anaerobic digestion: A critical review

This work presents a critical analysis for three models group of methanogen potential prediction. The first group allows determination of the methane productivity of substrates, through three models (BMPthCOD, BMPthAtC and BMPthOFC). The BMPthCOD is suitable for a first approximation calculation. BMPthAtC and BMPthOFC are more accurate; however, require a complex characterization of substrates. The second models group...

Author(s): Mohamed Mahmoud ALI, Nourou DIA, Boudy BILAL and Mamoudou NDONGO  

July 2018

Scientific Research and Essays
Indigenous knowledge on highland bamboo (Yushania alpina) management and utilization practices in Kokosa Woreda, South East Ethiopia

Bamboo is one of the world’s most important non-timber forest products (NTFPs) which have been advocated for poverty alleviation in many regions. However, in Ethiopia it is utilized below its potential due to lack of scientific knowledge and awareness on its management and utilization. Therefore, the main objective of this study was to investigate the indigenous knowledge of highland bamboo management and...

Author(s): Seyoum Gebrekidan, Lemma Tiki and Yigardu Mulatu  

July 2018

African Journal of Business Management
Diversity management discourse: An African perspective

This paper reviews the concept of diversity across selected sub-Saharan Africa countries. It focuses on the impact of social relations that depict cultural and social identities of individuals within these African countries. This is with the aim to help corporations develop diversity management strategies for their workforce. Consequently, this narrative paper adopts a qualitative approach, a literature survey that...

Author(s): Loliya Akobo and Osikwemhe Damisah  

July 2018

African Journal of Business Management
Attaining competitive advantage through energy efficiency: A cooperative strategic perspective

The Kenyan economy in the recent past has witnessed a considerable exit of multinational companies due to high-energy costs. Similarly, a comparative analysis among the East African community partners places the country among the list of those nations with high-energy charges levied on consumers. This phenomenon disadvantages the competitiveness of local industries while discouraging potential players. This is...

Author(s): Kiptum Henry Yatich  

Page 4 of 1131, showing 50 records out of 56511 total, starting on record 151, ending on 200