Full Length Research Paper

A 22-bp sequence of the core promoter from the Indica rice sucrose-phosphate synthase gene (sps1) is sufficient to confer basal transcription activity

Miguel Martínez-Trujillo¹, Gamaliel Valdivia-Rojas¹, Gloria Solís Guzmán¹, José Luis Cabrera-Ponce²

¹Facultad de Biología, Universidad Michoacana de San Nicolás de Hidalgo. Morelia, Michoacán,  México

²Departamento de Ingeniería Genética de Plantas, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, Unidad Irapuato, Irapuato, Guanajuato, México.

*Corresponding author: E-mail: codigogenetico@gmail.com. Tel-Fax: +52 (443) 3166973

Accepted 29 July 2008

   Abstract

The 5’ region of the sucrose-phosphate synthase gene (sps1) of the Indica rice consists of an atypical promoter which lacks TATA box but has a putative initiator sequence overriding a second transcription initiation site. Analysis of the transient expression of truncated versions of the sps1 promoter (from -148 to +21) fused to the uidA reporter gene was performed. The results showed that a stretch of 22 bp (GTGTCACCCGCCAGCCTCCCT), from -1 to +21, is sufficient to confer basal transcription activity. These data suggest that an initiator-like sequence (TCACCC) is the responsible of this basal activity.

Key words: Core promoter, sps1 gene, expression analysis.