Zaki and Abdel Ghany. Molecular distribution of gypsy-like retrotransposons in cotton Gossypium Spp. Afr. J. Biotechnol. 2003 May;2(5):124-128. [Full text]

PCR primers specific for conserved domains of the reverse transcriptase (RT) genes of gypsy-like retrotransposons amplified their corresponding gene in two Gossypium barbadense cultivars. Analysis with the FASTA software showed a high DNA sequence homology to pine, gypsy LTR-retrotransposon. Using the PCR product as a hybridization probe, gypsy-like retrotransposons were detected in wild type species of Gossypium, suggesting that gypsy-like retrotransposons are present in the Gossypium genome. This supports the view that gypsy-like retrotransposons are major components of plant genomes. Our results suggest gypsy-like retrotransposons have played a fundamental role in the shaping and evolution of the Gossypium genome.

Key words: Gossypium, gypsy, polyploidy, retroelements, retrotransposons, retroviruses, reverse transcriptase.

Abbreviations: Env, envelope gene; LTR, long terminal repeat; ORF, open-reading frame; PCR, polymerase chain reaction; RT, reverse transcriptase gene.

Introduction

Long terminal repeat, LTR-retrotransposons, are mobile genetics elements that encode their own reverse transcriptase (RT) for transposition (Malik et al., 2002, for review). Typically, retrotransposons contain two characteristic open-reading frames (ORFs). The gag gene (ORF1) encodes structural proteins and pol gene (ORF2) encodes protease, RT, RNase H, and integrase domains (Wilhelm and Wilhelm, 2001). Based on the order of the RT, and integrase domains in their pol genes, LTR-retrotransposons are divided into two groups: Ty1/copia and Ty3/gypsy elements (Xiong and Eickbush, 1990). The gypsy group elements have a similar organization to retroviruses and some encode a third ORF in the position occupied by the envelope, env, gene in retroviruses (Song et al., 1994).

The reverse transcriptase (RT) genes have conserved amino acid domains, some of which are characteristic of each retroelement group (Xiong and Eickbush 1990). In plants, degenerate oligonucleotide primers have been designed to amplify these domains by PCR and used fordetection and assessment of their distribution and evolution (Flavell et al., 1992; Voytas et al., 1992; Matsuoka 1999; Friesen et al., 2001). These results showed that retrotransposons are ubiquitous throughout the plant kingdom and constitute a major portion of the nuclear genomes (Kumar and Bennetzen, 1999). Therefore, the detailed characterization of different plant taxa with respect to the content, variability, and physical distribution of retrotransposons makes a major contribution to the understanding of host genome organization and evolution (Bennetzen, 2000).

The cotton genus, Gossypium L., comprise approximately 45 diploid and five allopolyploid species distributed throughout the arid and semi-arid regions of Africa, Central and South America, the Indian subcontinent, Arabia, the Galapagos, and Hawaii (reviewed by Wendel and Cronn, 2002). The diploid Gossypium species fall into eight cytological groups or genome designated A through G, and K. The five allotetraploid species, indigenous to the New World, derive from a single allopolyploidization event that united the Old World A genome with the New World D genome, in an A genome cytoplasm (Wendel, 1989). Here, we aimed to characterize gypsy-like retrotransposons in cotton. Using PCR primers specific for conserved domains of RT genes of gypsy-like retroelements, we studied their molecular distribution in representative Gossypium species. The analysis of the molecular existence and distribution of gypsy-like retrotransposons in cotton allows retrotransposon evolution to be studied in two levels: first, in the diploids, subsequent to their divergence from a common ancestor, and second, in the polyploid, after retrotransposons have been reunited in a common genome (Abdel Ghany and Zaki, 2002).

Plant materials

Gossypium wild type species and cultivars were kindly provided by Dr. A. Percival. Their genome descriptions are listed in Table 1.

Table 1. Description of Gossypium species studied.

Taxon	Genome*
G. herbaceum	A₁
G. arboreum	A₂
G. raimondii	D₅
G. gosspioides	D₆
G. barbadense	(AD)₂
G. darwinii	(AD)₅
G. mustelinum	(AD)₄
G. hirsutum	(AD)₁

DNA extraction

Total DNA was extracted using Qiagen DNeasy kit (Qiagen, Hilden, Germany).

Isolation of Ty3/gypsy-like reverse transcriptase gene in Gossypium

Total DNA was subjected to PCR with primers specific to the Ty3/gypsy reverse transcriptase gene. The forward and reverse primer sequences are (5`-CTAAGCTTTAYCAYCARHTNMGNAT-3`) and (5`- TCGAATTCTGNCCNARNMDYTYNAC-3`), where N= A+C+G+T, R= A+G, and Y= T+C (Xiong and Eickbush 1990). DNA amplifications were carried in an ABI GeneAmp PCR system 9700 cycler with a denaturing step at 95°C for 5 min and the step cycle program set for 45 cycles (with a cycle consisting of denaturing 94°C for 30s, annealing at 50°C for 30s and extension step at 72°C for 30s), followed by a final extension step at 72°C for 10 min. PCR fragments were then cloned in pCR 4-TOPO vector with TOPO TA cloning kit (Invitrogen, USA) in the competent E. coli strain TOPO 10. Plasmid DNA was isolated using QIA Spin mini-prep kit (Qiagen, Hilden, Germany). Plasmid DNA was sequenced in both directions using BigDye Sequencing Kit and ABI 3700 DNA sequencer (ABI, USA). Pairwise DNA sequence alignments were carried out using CLUSTALW (http://www2.ebi.ac.uk/clustalw; Thompson et al. 1994).

DNA HYBRIDIZATION

PCR amplified probes were labelled with [α-³²P] dCTP using the random primer method (Feinberg and Vogelstein, 1983), and used for DNA/RNA, and slot-blot hybridization as described (Sambrook et al., 1989). Filters were hybridized overnight at 42°C in a solution containing (50% foramide, 5 x SSC, 10 x Denhardt’s, and 0.5% SDS). Hybridization wash was carried out at 50°C in 0.1 x SCC containing 0.5% SDS for 1 h.

Results

The search for Ty3/gypsy-like reverse transcriptase gene in two cultivated G. barbandense cultivars, Giza 45 and 84, was carried out using specific oligonucleotide for the Ty3/gypsy reverse transcriptase gene (Xiong and Eickbush, 1990). This led in each case to the detection of 310 bp fragment. These fragments were designated G45 and G84 respectively. These fragments were cloned in pCR 4-TOPO vector, and plasmid DNAs were sequenced in both directions. G45 and G84 complete DNA sequence is 310 bp (Figures 1 and 2). G45 and G84 DNA sequences were deposited in the NCBI nucleotide sequencedatabase, GenBank; with the accession numbers U75247, U75248, respectively.

TCGAGATTCGGACGTACCCAAAACTGCTTTCAGAACGAGGTACGGTCACTA

CGAGTTCTTAGTGATGCCGTTCGGGCTCACTAATGCCCCTGCGGTATTTAT

GGATTTGATGAATCGGATCTTCAGACAGTATTTGGACCGGTTCGTAGTTGT

GTTCATTGATGACATCTTGGTCTATTCAGGAGATGAGACCGAACATGCTGA

GCACCTGAGATTAGTGTTGCAAATTTTGCGGGATAAGCAGTTATATGCTAA

GTTCAGTAAGTGTGAGTTCTGGTTAAGAGAGGTTAGCTTCTTGGGTCATGT

GGTA

Figure 1. DNA nucleotide sequence of G45. DNA sequence is given 5`-3`.

TGCGCGAGGGAGATGAGTGGAAAATAGCATTTAAAACTAAACATAGTTTGT

ACGAGTGGTTGGTAATGCCATTCGGTCTTACTAACACTTCTAGTACCTTTA

TGCGTTTAATGAACCATGTTCTGCGAGCTTTCATTGGTAAATTTTGTGTGG

TTTACTTTGATGATATTCTTGTTTATAGTAGATCCTTAGATGATCACTTAA

AGCATTTACGAGCTGTTCTTGATGTGTTGCGAAAGGAAAATTTATATGCCA

ATCTTAAGAAATGCACATTTTGTTCTAACCAAGTTGTTTTCCTAGGATTTG

TTGT

Figure 2. DNA nucleotide sequence of G84. DNA sequence is given 5`-3`.

Comparative nucleotide sequence analysis of G45 and G84 using the ClustalW program revealed that G45 and G84 are closely related, producing alignment score of 88.8% (Figure 3). Analysis with the FASTA software (Pearson and Lipman, 1988) using EMBL and EMBL plant database information indicated high homology of the pine, Ananas comosus, gypsy LTR-retrotransposon (Thomson et al., 1998), 68.5% identity (72.619% ungapped) and 68.5% identity (72.615% ungapped) with G45 and G84 respectively. It is noteworthy that G45 and G84 did not show close correspondence to previously reported Ty1/copia retrotransposons in G. hirsutum (Vanderwiel et al., 1993), nor to the major dispersed repeats in the cotton genome (Zhao et al., 1998), suggesting that a very complex population of such elements exists in cotton.

Figure 3. Comparative DNA sequence analysis of G45 and G84 using CLUSTALW.

The molecular distribution of gypsy-like retrotransposons in wild type species of the genus Gossypium was investigated using Southern blot. Total genomic DNAs from different Gossypium species were digested with HindIII and hybridized with G45 reverse transcriptase domain as a probe as shown in Figure 4 and Table 2. The detection of multiple hybridizing bands suggests the repetitive nature of these retroelements in the Gossypium genome. In addition, the pattern of the distribution of gypsy-like retrotransposons in these genomes is similar, with four common hybridization bands of 6.8, 4, 2.5, and 0.3 kb respectively. The observation of different band intensities within a single track may be attributed to sequence variations between gypsy-like retrotransposon-related sequences in these genomes. The fact that these genomes display a similar set of gypsy-like retrotransposon-specific restriction fragments suggest that the genomic locations of gypsy-like retrotransposon are similar within these different genomes. G. Barbadense (lane 5), however, showed a different pattern by possessing seven hybridization bands of 25, 23, 17, 10, 9, 6.4, and 3 kb respectively. The presence of sequences ranging from larger than 23 kb to smaller than 2 kb indicates the presence of a large family of related sequences.

Figure 4. Molecular distribution of gypsy-like-related sequences in Gossypium species. Gossypium DNAs were digested with HindIII and hybridized with G45 ³²P-labeled specific probe. Lane 1: G. herbaceum; Lane 2: G. arboreum; Lane 3: G. raimondii; Lane 4: G. gosspioides; Lane 5: G. barbadense; Lane 6: G. darwinii; Lane 7: G. mustelinum; Lane 8: G. hirsutum. Sizes of molecular weight markers, in kb, are indicated on the right.

Table 2. Sizes of gypsy-like-related sequences in Gossypium species. A: G. herbaceum; B: G. arboreum; C: G. raimondii; D: G. gosspioides; E: G. barbadense; F: G. darwinii; G: G. mustelinum; H: G. hirsutum. Sizes are given in kb.

A	B	C	D	E	F	G	H
				25
				23
				17
				10
				9
6.8	6.8	6.8	6.8	6.8	6.8	6.8	6.8
				6.4
4	4	4	4	4	4	4	4
				3
2.5	2.5	2.5	2.5	2.5	2.5	2.5	2.5
0.3	0.3	0.3	0.3	0.3	0.3	0.3	0.3

Discussion

Retrotransposons due to their abundance, diversity, and widespread distribution, make a major contribution to the shape as well as size of plant genomes (Bennetzen, 2002). PCR assays have been developed for isolation of amplified fragments of RT genes of retrotransposons using degenerate primers to conserved amino acid domains in many species (Flavell et al., 1992; Voytas et al., 1992; Matsuoka 1999; Friesen et al., 2001). In the current study, degenerate primers designed for gypsy elements amplified reverse transcriptase gene in two cultivated G. barbadense. In addition, with the PCR product as a hybridization probe, it was revealed that gypsy-like retrotransposons can be detected in wild type species of Gossypium, suggesting that gypsy-like retrotransposons is a standard component of the Gossypium genome, and supporting the fact that gypsy-like retrotransposons represents a major component of the plant genome (Freschotte et al., 2002).

The distribution pattern of gypsy-like retrotransposons within the genus Gossypium is similar, with G. barbadense possessing additional hybridisation bands. The additional hybridization bands in G. barbadense can be explained by one or more of the following mechanisms: a) deletions or additions in or near the gypsy-like retrotransposon element, loss or acquisition of restriction sites by single base changes or by changes in DNA modification such as methylation; b) homologous recombination of two gypsy-like retrotransposon elements resulting in deletion or inversion of the DNA between the gypsy-like retrotransposon elements on one chromosome, or in reciprocal translocation of chromosomal arms; c) transposition of a gypsy-like retrotransposon element including the reverse transcriptase domain to a new chromosomal location (Bennetzen, 2002). The cytosine residues in the CpG sequence are known to be frequently methylated in mammalian DNA (Barker et al., 1984). In plants, the cytosine residues in the CpNpG sequence are also methylated (Gardiner-Garden et al., 1992). HinddIII, the restriction enzyme used in this study, is sensitive to cytosine methylation. Hence, a part of the additional hybridization bands detected with this enzyme may be explained by methylation. However, two lines of evidence strongly, suggest that gypsy-like retrotransposon is an active retrotransposon in G. barbadense. First, gypsy-like retrotransposon -encoded transcripts were detectable (Abdel Ghany and Zaki, 2002). Second, an envelope, env-like sequences were reported in cultivated G. barbadense (Abdel Ghany and Zaki, 2002). Detection of gypsy-like retrotransposon-encoded transcripts and env-like sequences, intermediates in the retrotransposition process (Kumar and Bennetzen, 1999), suggests that a subset of these molecules is competent for retrotransposition.

Plant retrotransposons are largely inactive during normal development, but can be activated by stresses, such as wounding, pathogen attacks, and cell culture (Kumar and Bennetzen, 1999). Additionally, it has been documented that hybridization can activate retrotransposons (Liu and Wendel, 2000). Hybridization is a prominent feature of natural plant populations, and one that often leads to speciation either through polyploidization or at the diploid level (Wendel, 2000). In this regard, the fact that G. barbadense represents an allopolyploid cotton that appears to have arisen as a consequence of trans-oceanic dispersal of an A-genome taxon to the New World followed by hybridization with an indigenous D-genome diploid (Wendel and Cronn, 2002) raises the question to the effect that hybridization may have had on the gypsy-like retrotransposons in G. barbadense. The detection of additional hybridization bands in G. barbadense could be the result of the hybridization process. The absence of these additional bands in the other allopolyploids, namely, G. darwinii, G. hirsutum and G. mustelinum, however, argues against this suggestion. Alternatively, these additional gypsy-elements could be the result of a massive amplification process of gypsy-like retrotransposons in G. barbadense since the divergence of G. barbadense, and the remaining allopolyploids from a common ancestor. This suggestion is supported by the massive amplification process observed in maize since its divergence from the common ancestor with sorghum (SanMiguel and Bennetzen, 1998). Further experimental data such as copy number determination, chromosomal distribution, and sequencing of large contiguous regions of the genome as it has been previously demonstrated in maize (SanMiguel and Bennetzen, 1998) will significantly add up fundamental knowledge about the role of gypsy-like retrotransposons in shaping and evolution of the Gossypium genome.

Finally, the unique properties of retrotransposons have been exploited as genetic tools for plant genome analysis (Kumar and Hirochika, 2001). In this regard, our results in this report and the detection of env-like sequences in Gossypium (Abdel Ghany and Zaki, 2002) promote the initiative to employ these retroelements in cotton genome analysis. Gypsy-like elements should provide the means to fulfil major applications such as determining phylogeny and genetic diversity and in functional analyses of genes in Gossypium.

ACKNOWLEDGEMENT

This work was supported by a grant from the US-Egypt Science and Technology Foundation to E.A. Zaki.

References