home about us journals search

African Journal of Biotechnology

     

   AJB Home

   About AJB

   Submit Manuscripts

   Instructions for Authors

   Editors

   Call For Paper

   Archive

   Faculty 1000

   Conferences

   Associations

  Afr. J. Biotechnol.

  Vol. 11 No. 2

  Viewing options:

    • Abstract
    •Reprint (PDF) (1007K)

Search Pubmed for articles by:

  Ding X

  Zhou H-Y

 


 Other links:

PubMedCitation

RelatedarticlesinPubMed

 

 

African Journal of Biotechnology Vol. 11 (2), pp. 337-345, 5 January, 2012

DOI: 10.5897/AJB10.489

ISSN 1684-5315 © 2012 Academic Journals                                

 

Full Length Research

 

Diversity of bacteria and archaea in the deep-sea low-temperature hydrothermal sulfide chimney of the Northeastern Pacific Ocean

 

Xia Ding1*, Xiao-Jue Peng1#, Xiao-Tong Peng2 and Huai-Yang Zhou3

 

1College of Life Sciences and Key Laboratory of Poyang Lake Environment and Resource Utilization, Ministry of Education, Nanchang University, Nanchang 330031, China.

2Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, Guangzhou 510640, China.

3National Key Laboratory of Marine Geology, Tongji University, Shanghai 200092, China.

 

*Corresponding author. E-mail: dingxia97@ncu.edu.cn. Tel/Fax: +86 791 3969163.

 

#Both authors contributed equally to the work.

 

Accepted 4 November, 2011

 

   

Abstract

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

Our knowledge of the diversity and role of hydrothermal vents microorganisms has considerably expanded over the past decade, while little is known about the diversity of microorganisms in low-temperature hydrothermal sulfide chimney. In this study, denaturing gradient gel electrophoresis (DGGE) and 16S rDNA sequencing were used to examine the abundance and diversity of microorganisms from the exterior to the interior of the deep sea low-temperature hydrothermal sulfide chimney of the Northeastern Pacific Ocean. DGGE profiles revealed that both bacteria and archaea could be examined in all three zones of the chimney wall and the compositions of microbial communities within different zones were vastly different. Overall, for archaea, cell abundance was greatest in the outermost zone of the chimney wall. For bacteria, there was no significant difference in cell abundance among three zones. In addition, phylogenetic analysis revealed that Verrucomicrobia and Deltaproteobacteria were the predominant bacterial members in exterior zone, beta Proteobacteria were the dominant members in middle zone, and Bacillus were the abundant microorganisms in interior zone. As to archaea, the middle and exterior were dominated by unclassified archaea, while interior zone was dominated by methanogens. Taken together, these results show that there was a transition in the composition of microbial communities across the sulfide chimney wall. Our findings provide helpful information for understanding the diversity and phylogeny of microorganisms in the deep-sea low temperature hydrothermal sulfide chimney.

 

Key words: Low-temperature hydrothermal sulfide chimney, bacteria, archaea, DGGE.

 

 

 

Introduction

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

 

Deep-sea hydrothermal vents and their attendant invertebrate communities were discovered in 1977 during exploration of the Galapagos Spreading Center (Van Dover et al., 2002). Vents are now known to occur along all active mid-ocean ridges and back-arc spreading centers and at some seamounts. Hydrothermal sulfide chimneys are found on the deep seafloor, and the mineral structure of chimneys consisted of sulfides minerals such as chalcopyrite (CuFeS2), iron disulfide (FeS2), [(zinc (Zn), iron (Fe)) sulphide (S)] and others. Thermal and chemical gradients are created by mixing of reduced hot fluids with oxygenated cold seawater (Moyer et al., 1995). Sulfide chimneys present in marine hydrothermal systems are created by hot, metal-enriched fluids (Kato et al., 2010; Schrenk et al., 2003).

   Although deep-sea hydrothermal vents are among the most extreme and dynamic environments on earth, biologically diverse communities exist in the immediate vicinity of hydrothermal vent flows (Thornburg et al., 2010). It was discovered that microorganisms are incredibly diverse and believed to be performing critical roles in the hydrothermal systems (Zhou et al., 2009). The most widely accepted (or at least hypothesized) mode of metabolism thought to dominate hydrothermal vent microbial communities is chemolithoautotrophy, principally through the oxidation of reduced sulfur and iron compounds as an energy source (Jannasch and Mottl, 1985; Van Dover et al., 2002). Most recent enrichment culture isolation experiments revealed the presence of a physiologically diverse microbial community and led to the characterization of numerous bacterial and archaeal thermophiles (and hyperthermophiles), including both chemolithoautotrophic and chemoorganoheterotrophic strains (Harmsen et al., 1997). The microorganisms isolated at great depths so far were sulfate reducer, chemolithotrophic methanogens (Kelly et al., 2010; Kurr et al., 1991; Takaki et al., 2010), thermophilic aerobic heterotrophic bacteria from the genera Thermus and Bacillus (Marteinsson et al., 1996), heterotrophic sulfur metabolizers from the order Thermococcales (Gonzalez et al., 1995), a variety of fermenters within the Crenarchaeota (Jannasch et al., 1988) and others.

However, the major limitation of culture-based techniques is that only a relatively small fraction of the microorganisms making up a natural community can generally be cultured, especially for the deep-sea hydro- thermal vents ecosystem (Heidelberg et al., 2010; Podosokorskaya et al., 2010). Fortunately, molecular analyses based on 16S rDNA gene fragment such as denaturing gradient gel electrophoresis (DGGE), is more and more frequently used to explore the microbial com- munities and their dynamics changes recently (Hirasawa et al., 2008; Takai and Horikoshi, 1999a). Furthermore, although successful, the potentials and limitations of these techniques can be sometimes met (Muyzer and Smalla, 1998). New information is rapidly flowing into the field from the cultivation of key organisms, in situ hybridization, to metagenomics and ongoing biogeo- chemical studies (Burgaud et al., 2010; Corre et al., 2001; Ehrhardt et al., 2009; Genilloud et al., 2010; Giovannoni and Stingl, 2005; Xie et al., 2010).

Our knowledge of the diversity and role of hydrothermal vents micro-organisms has considerably expanded over the past decade, while little is known about the diversity of microorganisms in low-temperature hydrothermal sulfide chimney. In this paper, we described the microbial communities within discrete mineralogical zones from clam bed. The zones represent diverse physical-chemical environments due to their spatial location within the low-temperature hydrothermal sulfide chimney wall. The bacterial and archaeal abundance and diversity were analyzed from the exterior to the interior of sulfide chimney using DGGE and 16S rDNA sequencing. In addition, the bacterial and archaeal populations in the deep-sea hydrothermal vent environments were com- pared with those of other deep-sea hydrothermal vent ecosystems, and the genetic diversity and phylogenetic analyses of the microbes were examined.

 

 

 

                             Table 1. Primers used for PCR of 16S rDNA.

 

Primera

Target siteb

Sequence (5’ to 3’)

Specificity

Reference

BSF8/20

8-27

AGAGTTTGATCCTGGCTCAG

Bacteria

(LaPara et al., 2000)

968Fc

968–984

AACGCGAAGAACCTTAC

Bacteria

(Felske and Akkermans, 1998)

1401R

1385-1401

CGGTGTGTACAAGACCC

Bacteria

(Felske and Akkermans, 1998)

BSR1541/20

1541-1522

AAGGAGGTGATCCAGCCGCA

Bacteria

(LaPara et al., 2000)

PRA46F

46-60

YTA AGC CAT GCR AGT

Archaea

(O'Connell et al., 2003)

PARCH340Fc

340-357

CCC TAC GGG GYG CAS CAG

Archaea

(O'Connell et al., 2003)

ARC915R

915-934

GTG CTC CCC CGC CAA TTC CT

Archaea

(O'Connell et al., 2003)

PREA1100R

1100-1117

YGG GTC TCG CTC GTT RCC

Archaea

(O'Connell et al., 2003)

 

aF, forward primer; R, reverse primer. bNumbering based on Escherichia coli numbering scheme; cGC-clamp sequence, 5’-CGC CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG G-3’ attached to 5’ end of the primer.

 

   

Materials and Methods

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

Sampling

 

China and USA Joint Diving Cruise by R/V Atlantis and Submersible Alvin was made on clam bed (129°5.8' W, 47°48' N) in Northeastern Pacific Ocean in 19th August, 2005. Samples used in the study were obtained from a deep-sea low-temperature hydrothermal sulfide chimney during dive 4136. Three discrete horizontal transects across the chimney wall were taken for analysis. The temperature of the hydrothermal sulfide liquid was 29.2°C. The depth of hydro- thermal sulfide chimney was 2181.292 m.

 

 

Nucleic acid extraction

 

Total genomic DNA was extracted from 0.5 g of samples from each of the three vertical zones of the core using an UltraCleanTM Soil DNA extraction kit (MO BIO, USA) according to the protocol supplied with the kit. The DNA was resuspended in sterile water and the DNA concentration was measured using a Nano-volume spectrophoto- meter (Analytik Jena, Germany).

 

 

Polymerase chain reaction (PCR) - DGGE analysis

 

The primers used for amplification of 16S rDNA of bacteria and archaea are listed in Table 1. Amplification mixtures with bacteria primers BSF8/20 and BSR1541/20 was performed. The reaction began with an initial 95°C denaturation for 5 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 1.5 min and a final extension at 72°C for 10 min. The second amplification was per- formed using the same setting as in the first round of amplification, except with an extension time of 30 s. Moreover, amplification of archaea 16S rDNA sequences was carried out using a nested PCR technique. First, the majority of the archaea 16S rDNA fragment was amplified using the PRA46F and PREA1100R primers (Table 1). The first amplification mixture contained the same concentration of components as in the bacteria mixture. Polymerase chain reaction (PCR) began with a 95°C denaturation for 5 min, followed by 30 cycles of at 95°C for 30 s, 54°C for 30 s, 72°C for 1 min and a final extension at 72°C for 10 min.

For PCR-DGGE analysis, nest-PCR was performed using the same PCR reagents and thermal cycling parameters as aforementioned, except that the primers used were 340F with a stretch of guanine cytosine-rich sequences (GC-clamp) and 915R. DGGE was performed essentially as previously described (Muyzer et al., 1993). Briefly, PCR products were separated on a 1 mm thick, vertical gel containing 6% (w/v) polyacrylamide (37.5:1 acrylamide: bisacrylamide) and a linear gradient of the denaturants urea and formamide, increasing from 30% at the top of the gel to 60% at the bottom. Here, 100% denaturant was defined as 7 mol/L urea plus 40% v/v formamide. The gels were loaded with 50 μL of PCR product. Electrophoresis was performed in a buffer containing 40 mmol/L  Tris, 40 m mol/L acetic acid, 1 mmol/L EDTA (pH 7.6) (0.5 Tris–acetate–EDTA buffer) for 5 h at 160 V. Finally, gels were stained by silver staining.

 

 

 

 

 

 

Sequencing of 16S rDNA fragments and comparative sequence analysis

 

Individual bands were cut from the DGGE gel using new razor blades, placed in 200 μL of sterile distilled recovery buffer (20% (v/v) ethanol, 1 mol/L LiCl, 10 mmol/L Tris-HCl (pH 7.5)), and allowed to incubate overnight at room temperature, then incubated further for 2 h at 65°C. The supernatant containing the eluted DGGE band was recovered and placed in a new sterile microcentrifuge tube. The eluted band was re-amplified with non-GC-clamped primers 968F/1401R and primers PARCH340F/ ARC915R for bacteria and archaea, respectively. Two microliters of PCR product was ligated into pUCm-T vector (Bio Basic Inc.) and transformed to E. coli DH5α. The cloning procedure was conducted according to the manufacturer’s instructions.

One to two clones from each band as shown in the Figure 1 were sequenced. Sequences were deposited in GenBank (accession numbers EF422853 through EF422863) and aligned with reference sequences, using sequence match software from the Ribosomal Database Project II (RDP II) website (Cole et al., 2005). All sequences were aligned  in a two-stage process. Distance matrices were constructed from the aligned sequences in the ClustalX v1.8 program. Using the PHYLIP program, a phylogenetic tree was constructed by neighbor-joining method. Bootstrapping was performed using the bootstrap modus of the program.

 

 

 

                                      Table 2. Phylogenetic affiliations of clones 16S rDNA genes from the deep-sea hydrothermal sulfide chimney.

 

 

Phylogenetic affiliation

Sequenced clone number

GenBank accession number

Position on site

Bacteria

Verrucomicrobia

1

EF422853

a

 

 

 

 

Delta proteobacteria; unclassified Syntrophobacterales

2

EF422854

a

 

 

 

 

Beta proteobacteria; Neisseriales

3

EF422855

b

Beta proteobacteria; Comamonadaceae

4

EF422856

b

Bacillus

5

EF422857

c

 

 

 

 

 

Archaea

Uncultured Archaea

6

EF422858

a

7

EF422859

a

8

EF422860

a

9

EF422861

b

 

 

 

 

Methanothermobacter

10

EF422862

c

11

EF422863

c

 

                                     a, The exterior of sulfide chimney; b, the middle of sulfide chimney; c, the interior of sulfide chimney.

 

   

Results

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

The diversity of microorganisms from the exterior to the interior of sulfide chimney

 

The abundance and diversity of microbial communities from the exterior to the interior of sulfide chimney were investigated by PCR-DGGE method. DGGE profiles showed that bacteria and archaea could be examined in all three zones of the chimney wall and samples in the three zones display different migration patterns, which revealed that the compositions of microbial communities within different zones were vastly different. About 20 bacterial and 10 archaeal distinguishable bands were observed in different zones of sulfide chimney, respec- tively. For bacteria, there was no significant difference in the amount of DNA bands among three zones. While for archaea, the total amount of DNA bands in exterior was higher than both middle and interior, which indicated that cell abundance was greatest in the outermost zone of the chimney wall (Figure 1) as shown by phylogenetic analy- sis of 16SrDNA of the microorganisms in different zones.

To examine the diversity of the microorganisms communities present at different locations within the sulfide chimney, five most intensive bands from bacterial community and six most thickness bands from archaeal community were excised from DGGE gel respectively and subsequently cloned for sequencing. Results show that Verrucomicrobia and Deltaproteobacteria were the predominant bacterial members in exterior, beta Proteobacteria were the dominant members in middle zones, and Bacillus were the abundant microorganisms in interior. As to these archaea, the six sequences were most similar to two large categories: one consisted of Methano- thermobacter and the other was unclassified archaea. It was noticed that interior is dominated by methanogens, while the middle and exterior were dominated by unclassified archaea (Table 2). These results suggest that there was a transition in the composition of microbial commu- nities across the sulfide chimney wall.

Furthermore, phylogenetic tree analysis showed that five bacterial DNA fragments detected were related to the several groups (Figure 2). Clone 1 was related to members of the uncultured Verrucomicrobia previously detected in association with mucous secretions of the hydrothermal vent polychaete Paralvinella palmiformis (P. palm C 41, GenBank AJ441225) (Alain et al., 2002) and Cytophaga sp. enrichment cultures with Alvinella pompe- jana white tubes collected on East Pacific Rise at 13°N (Dex80-43, GenBank AJ431234; Unpublished results). Hence, we assigned it as Verrucomicrobia. In addition, clone 2 was found to be most closely related to unclassified Syntrophobacterales collected in deep sea hydrothermal vent field in Mid Atlantic Ridge (PICO pp37 Rainbow 102, GenBank AJ969442, Unpublished results), unclassified Syntrophobacterales obtained from sediment-hosted carbon(iv)oxide (CO2) lake of the southern Okinawa Trough hydrothermal system (OT-B08.16, GenBank AB252432) (Inagaki et al., 2006) and unclassified Desulfobulbaceae clone from deep-groundwater microorganism (KNA6-EB15, GenBank AB179691) (Miyoshi et al., 2005). Clones 3 and 4 were classified as members of the beta Proteobacteria. Clone 4 was related to sequences retrieved from thermophiles and hyperthermophiles in deep-subsurface geothermal environments (RVW-01, GenBank AB199568) (Kimura et al., 2006) and a Ramlibacter henchirensis isolated from subdesert soil in Tunisia (GenBank AF439400) (Heulin et al., 2003). Clone 5 was placed in the phylum of Bacillus.

Phylogenetic tree analysis indicated that the 6 archaeal rDNA fragments obtained from three zones were found to fall into three large phylogenetic assemblages: one consisted of the very deep lineages of rDNA sequences within the methanogens and the other two were placed in an intermediate position between the uncultured Crenar- chaeota and Euryarchaeota kingdoms and assigned as unclassified Archaea. Additionally, clone 6 was closely related to three other sequences, one from an active deep-sea vent chimney sample (PS-A8, GenBank AY280451) (Page et al., 2004), one from nascent hydrothermal chimney (F99a6. GenBank DQ228515. Schrenk et al., unpublished results), and one from a deep-sea hydrothermal vent environments (pMC2A209, GenBank AB019719) (Takai and Horikoshi, 1999b). The clones 7, 8 and 9 were in the same cluster of sequences with 96 to 99% sequence identity to other uncultured archaen clones (Figure 2b). The sequence corresponding to clones 10 and 11 was a deep lineage within the archaea, and most closely associated with the Methanothermobacter.

 

 

 

 

 

 

 

 

 

 

 

   

Discussion

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

Thermal and chemical gradients within the wall of hydro- thermal sulfide chimney can select for and sustain organisms adapted to specific environmental conditions. On this basis, the compositions of microbial communities within different microenvironments, such as the exterior and interior of a sulfide chimney, are expected to be vastly different (Schrenk et al., 2003). However, large numbers of research are focus on the high-temperature hydro- thermal chimney, hence little is known about the diversity of microorganisms in low-temperature hydrothermal sulfide chimney.

The low-temperature hydrothermal sulfide chimney from clam bed is characterized by an abundance of oxidized sulfide minerals and presence of macrofauna, which may support unique microbial communities adapted to this favorable metabolic couple. Previous microbial diversity studies in high-temperature hydrothermal sulfide vent areas have shown that anaerobic archaea (e.g. Thermo- coccales, Archaeoglobales and Methanococcales) and sulfate reducer bacteria (e.g. delta and epsilon Proteobacteria) can be dominant members and may be important mediators of both the sulfur and nitrogen cycling in hydrothermal vent ecosystems (Longnecker and Reysenbach, 2001; Reed et al., 2006; Voordeckers et al., 2005). Our results indicate that the microbial community structure shifted, significantly alters across the sulfide chimney wall in the low-temperature hydrothermal sulfide chimney, ranging from delta Proteobacteria and uncultured archaea near the exterior of the chimney to predominantly beta Proteobacteria, Methanothermobacter and uncultured archaea near the interior of the chimney. A broad diversity of phylotypes belonging to other bacterial divisions was detected, including Verrucomicrobia and Bacillus. Clone 1 was assigned to phylum Verrucomicrobia. It was related to members of the uncultured Verrucomi- crobia previously detected in association with mucous secretions of the hydrothermal vent polychaete P. palmiformis, which were two sulfide chimneys of CASM vent field (on T and S chimney, 130° 01' W 45° 59' N; depth, 1546 m) and ASHES vent field (on Hell chimney, 130° 01'W 45° 56' N; depth, 1580 m) close to our sampling site (Alain et al., 2002). Verrucomicrobia was also detected with the chitin tubes of the giant vent tubeworm Riftia pachyptila (collected at the East Pacific Rise, 9° N and 13° N) (Lopez-Garcia et al., 2002). More- over, it was not strange to find some ectosymbionts or symbionts in the clam bed.

The presence of delta Proteobacteria (Syntrophobacteraceae) in the venting chimney suggested that sulfur-related metabolism was common and crucial  to  the  vent  ecosystem. The chimney’s abundant uncultured archaea and Methanothermobacter, likely reflected sulfate, elevated hydrogen and CO2 providing important energy sources for microbial life at the hydrothermal vents, and the chimney structures are likely to favor anaerobic niches and the temperature ranges from 50 to 70° in the interior zone of the chimney wall. Diverse uncultivated archaea species are known to be associated with chimney. Cultivation work was done in the laboratory, but there was no archaea isolated. Figure 3 depicts a biogeochemical model of carbon and sulfur cycling in the low-temperature hydrothermal sulfide chimney. The system is characterized by the interaction of H2- and CH4- rich hydrothermal fluid with oxygenated seawater. Sulfur-related metabolism is common and crucial to the ecosystem. Biofilms of methanogen are restricted to high-temperature anoxic zones; hence clam and shrimp are common there.

 

 

 

 

 

   

Conclusion

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

Ongoing analyses of several sulfide chimneys are providing multifaceted maps of the vent chimneys and are allowing integration of multiple data sets into a coherent biogeochemical model. Our findings provide helpful information for understanding the diversity and phylogeny of microorganisms in the deep-sea low-temperature hydrothermal sulfide chimney. In the future, we hope to perform fluorescent in situ hybridization (FISH) and PCR with primers on functional genes etc., to uncover more information in the deep-sea low-temperature hydro- thermal sulfide chimney.

 

 

Acknowledgements

 

This work was supported by Prof. You-Lin Zhu, Prof. Wei-Jun Yang and Key Laboratory of Poyang Lake Environment and Resource Utilization, Ministry of Education (Z04996), National Natural Science foundation of China (31160019) and the COMRA Project (DY 105-02-10).

 

 

   

References

 

Abstract

Introduction

Materials and Methods

Results

Discussion

Conclusion

References

 

 

Alain K, Olagnon M, Desbruyeres D, Page A, Barbier G, Juniper SK, Querellou J, Cambon-Bonavita MA (2002). Phylogenetic characterization of the bacterial assemblage associated with mucous secretions of the hydrothermal vent polychaete Paralvinella palmiformis. FEMS Microbiol. Ecol. 42: 463-476.

 

Burgaud G, Arzur D, Durand L, Cambon-Bonavita MA, Barbier G (2010). Marine culturable yeasts in deep-sea hydrothermal vents: species richness and association with fauna. FEMS Microbiol. Ecol. 73: 121-133.

 

Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM, Garrity GM, Tiedje JM (2005) The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res. 33: D294-296.

 

Corre E, Reysenbach AL, Prieur D (2001). Epsilon-proteobacterial diversity from a deep-sea hydrothermal vent on the Mid-Atlantic Ridge. FEMS Microbiol. Lett. 205: 329-335.

 

Ehrhardt CJ, Haymon RM, Sievert SM, Holden PA (2009). An improved method for nanogold in situ hybridization visualized with environmental scanning electron microscopy. J. Microsc. 236: 5-10.

 

Felske A, Akkermans ADL (1998). Spatial Homogeneity of Abundant Bacterial 16S rRNA Molecules in Grassland Soils. Microb. Ecol. 36: 31-36.

 

Genilloud O, Gonzalez I, Salazar O, Martin J, Tormo JR, Vicente F (2010). Current approaches to exploit actinomycetes as a source of novel natural products. J. Ind. Microbiol. Biotechnol. 38(3): 375-389.

 

Giovannoni SJ, Stingl U (2005) Molecular diversity and ecology of microbial plankton. Nature, 437: 343-348.

 

Gonzalez JM, Kato C, Horikoshi K (1995). Thermococcus peptonophilus sp. nov., a fast-growing, extremely thermophilic archaebacterium isolated from deep-sea hydrothermal vents. Arch. Microbiol. 164: 159-164.

 

Harmsen H, Prieur D, Jeanthon C (1997). Distribution of microorganisms in deep-sea hydrothermal vent chimneys investigated by whole-cell hybridization and enrichment culture of thermophilic subpopulations. Appl. Environ. Microbiol. 63: 2876-2883.

 

Heidelberg KB, Gilbert JA, Joint I (2010). Marine genomics: at the interface of marine microbial ecology and biodiscovery. Microb. Biotechnol. 3: 531-543.

 

Heulin T, Barakat M, Christen R, Lesourd M, Sutra L, De Luca G, Achouak W (2003). Ramlibacter tataouinensis gen. nov., sp. nov., and Ramlibacter henchirensis sp. nov., cyst-producing bacteria isolated from subdesert soil in Tunisia. Int. J. Syst. Evol. Microbiol. 53: 589-594.

 

Hirasawa JS, Sarti A, Del Aguila NK, Varesche MB (2008). Application of molecular techniques to evaluate the methanogenic archaea and anaerobic bacteria in the presence of oxygen with different COD:sulfate ratios in a UASB reactor. Anaerobe 14: 209-218.

 

Inagaki F, Kuypers MM, Tsunogai U, Ishibashi J, Nakamura K, Treude T, Ohkubo S, Nakaseama M, Gena K, Chiba H, Hirayama H, Nunoura T, Takai K, Jorgensen BB, Horikoshi K, Boetius A (2006). Microbial community in a sediment-hosted CO2 lake of the southern Okinawa Trough hydrothermal system. Proc. Natl. Acad Sci. U. S. A. 103: 14164-14169.

 

Jannasch HW, Mottl MJ (1985). Geomicrobiology of deep-sea hydrothermal vents. Science, 229: 717-725.

 

Jannasch HW, Wirsen CO, Molyneaux SJ, Langworthy TA (1988). Extremely thermophilic fermentative archaebacteria of the genus desulfurococcus from deep-sea hydrothermal vents. Appl. Environ. Microbiol. 54: 1203-1209.

 

Kato S, Takano Y, Kakegawa T, Oba H, Inoue K, Kobayashi C, Utsumi M, Marumo K, Kobayashi K, Ito Y, Ishibashi J, Yamagishi A (2010). Biogeography and biodiversity in sulfide structures of active and inactive vents at deep-sea hydrothermal fields of the Southern Mariana Trough. Appl. Environ. Microbiol. 76: 2968-2979.

 

Kelly S, Wickstead B, Gull K (2010). Archaeal phylogenomics provides evidence in support of a methanogenic origin of the Archaea and a thaumarchaeal origin for the eukaryotes. Proc. Biol. Sci.

 

Kimura H, Sugihara M, Kato K, Hanada S (2006). Selective phylogenetic analysis targeted at 16S rRNA genes of thermophiles and hyperthermophiles in deep-subsurface geothermal environments. Appl. Environ. Microbiol. 72: 21-27.

 

Kurr M, Huber R, König H, Jannasch HW, Fricke H, Trincone A, Kristjansson JK, Stetter KO (1991). Methanopyrus kandleri, gen. and sp. nov. represents a novel group of hyperthermophilic methanogens, growing at 110°C. Arch. Microbiol. 156: 239-247.

 

LaPara TM, Nakatsu CH, Pantea L, Alleman JE (2000). Phylogenetic analysis of bacterial communities in mesophilic and thermophilic bioreactors treating pharmaceutical wastewater. Appl. Environ. Microbiol. 66: 3951-3959.

 

Longnecker K, Reysenbach A (2001). Expansion of the geographic distribution of a novel lineage of epsilon-Proteobacteria to a hydrothermal vent site on the Southern East Pacific Rise. FEMS Microbiol. Ecol. 35: 287-293.

 

Lopez-Garcia P, Gaill F, Moreira D (2002). Wide bacterial diversity associated with tubes of the vent worm Riftia pachyptila. Environ. Microbiol. 4: 204-215.

 

Marteinsson VT, Birrien JL, Jeanthon C, Prieur D (1996). Numerical taxonomic study of thermophilic Bacillus isolated from three geographically separated deep-sea hydrothermal vents. FEMS Microbiol. Ecol. 21: 255-266.

 

Miyoshi T, Iwatsuki T, Naganuma T (2005). Phylogenetic characterization of 16S rRNA gene clones from deep-groundwater microorganisms that pass through 0.2-micrometer-pore-size filters. Appl. Environ. Microbiol. 71: 1084-1088.

 

Moyer CL, Dobbs FC, Karl DM (1995). Phylogenetic diversity of the bacterial community from a microbial mat at an active, hydrothermal vent system, Loihi Seamount, Hawaii. Appl. Environ. Microbiol. 61: 1555-1562.

 

Muyzer G, de Waal EC, Uitterlinden AG (1993). Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695-700.

 

Muyzer G, Smalla K (1998). Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van Leeuwenhoek, 73: 127-141.

 

O'Connell SP, Lehman RM, Snoeyenbos-West O, Winston VD, Cummings DE, Watwood ME, Colwell FS (2003). Detection of Euryarchaeota and Crenarchaeota in an oxic basalt aquifer. FEMS Microbiol. Ecol. 44: 165-173.

 

Page A, Juniper K, Olagnon M, Alain K, Desrosiers G, Querellou J, Cambon-Bonavita MA (2004). Microbial diversity associated with a Paralvinella sulfincola tube and the adjacent substratum on an active deep-sea vent chimney. Geobiology, 2: 225-238.

 

Podosokorskaya OA, Kublanov IV, Reysenbach AL, Kolganova TV, Bonch-Osmolovskaya  EA (2010).  Thermosipho affectus sp. nov., a novel thermophilic anaerobic cellulolytic bacterium isolated from a Mid-Atlantic Ridge hydrothermal vent. Int. J. Syst. Evol. Microbiol. 61(5): 1160-1164.

 

Reed AJ, Lutz RA, Vetriani C (2006). Vertical distribution and diversity of bacteria and archaea in sulfide and methane-rich cold seep sediments located at the base of the Florida Escarpment. Extremophiles, 10: 199-211.

 

Schrenk MO, Kelley DS, Delaney JR, Baross JA (2003). Incidence and diversity of microorganisms within the walls of an active deep-sea sulfide chimney. Appl. Environ. Microbiol. 69: 3580-3592.

 

Takai K, Horikoshi K (1999a). Genetic diversity of archaea in deep-sea hydrothermal vent environments. Genetics 152: 1285-1297.

 

Takai K, Horikoshi K (1999b). Genetics Society of America, Genetic Diversity of Archaea in Deep-Sea Hydrothermal Vent Environments. Genetics, 152: 1285-1297.

 

Takaki Y, Shimamura S, Nakagawa S, Fukuhara Y, Horikawa H, Ankai A, Harada T, Hosoyama A, Oguchi A, Fukui S, Fujita N, Takami H, Takai K (2010). Bacterial lifestyle in a deep-sea hydrothermal vent chimney revealed by the genome sequence of the thermophilic bacterium Deferribacter desulfuricans SSM1. DNA Res. 17: 123-137.

 

Thornburg CC, Zabriskie TM, McPhail KL (2010). Deep-sea hydrothermal vents: potential hot spots for natural products discovery? J. Nat. Prod. 73: 489-499.

 

Van Dover CL, German CR, Speer KG, Parson LM, Vrijenhoek RC (2002). Evolution and biogeography of deep-sea vent and seep invertebrates. Science, 295: 1253-1257.

 

Voordeckers JW, Starovoytov V, Vetriani C (2005). Caminibacter mediatlanticus sp. nov., a thermophilic, chemolithoautotrophic, nitrate-ammonifying bacterium isolated from a deep-sea hydrothermal vent on the Mid-Atlantic Ridge. Int. J. Syst. Evol. Microbiol. 55: 773-779.

 

Xie W, Wang F, Guo L, Chen Z, Sievert SM, Meng J, Huang G, Li Y, Yan Q, Wu S, Wang X, Chen S, He G, Xiao X, Xu A (2010). Comparative metagenomics of microbial communities inhabiting deep-sea hydrothermal vent chimneys with contrasting chemistries. ISME J. 5(3): 414.

 

Zhou H, Li J, Peng X, Meng J, Wang F, Ai Y (2009). Microbial diversity of a sulfide black smoker in main endeavour hydrothermal vent field, Juan de Fuca Ridge. J. Microbiol. 47: 235-247.

 

___________________________________________________________________________________________________________________________

Advertise on AJB | Terms of Use | Privacy Policy | Help

© Academic Journals 2002 - 2012