| |
|
|
|
|
|
|
Full Length
Research
|
|
β-Cyclodextrin-curcumin
complex inhibit telomerase gene expression in T47-D
breast cancer cell line
Fatemeh Kazemi1, 3,
Nosratollah Zaraghami1*, Sedighe Fekri aval1
and Amir Monfaredan2
1Drug Applied Research
Center, Tabriz University of Medical Sciences, Faculty of
Medicine, Department of Medical Biotechnology, Tabriz, Iran.
2Tabriz University of
Medical Sciences, Faculty of Medicine, Department of
Immunology, Division of hematology, Tabriz, Iran.
3Pasteur Institute of Iran,
Tehran, Iran.
*Corresponding author.
E-mail :
Zarghami@tbzmed.ac.ir or
Fatemeh1044@yahoo.com.
Tel : +98-411-3364666.
Fax: +98-411-3364666.
Abbreviations: PCR,
Polymerase chain reaction; MTT, colorimetric cell
viability assay; hTERT, telomerase; PLGA, poly
lactic-co-glycolic acid; DMSO, dimethylsulfoxide.
Accepted 5 October, 2011
|
|
|
|
|
|
Abstract |
|
|
|
Today, attempt to
the
preparation of stable drug with high drug delivery efficiency is
inevitable. Curcumin (diferuloylmethane), with hydrophobic
structure obtained from the herb of Curcuma longa, have
various applications in cancer therapy. But, its low water
solubility and bioavailability is possible for poor drug
delivery of curcumin. In this study,
we prepared β-cyclodextrin-curcumin complex to determine
the
inhibitory effect of this drug on telomerase gene expression.
Curcumin
was
encapsulated into cyclodextrin and the rate of curcumin loading
was estimated. Cytotoxic effects of β-cyclodextrin curcumin were
investigated by colorimetric cell viability (MTT) assay.
Then inhibition of telomerase gene expression was determined by
real-time polymerase chain reaction (PCR). MTT assay
demonstrated that β-cyclodextrin have no cytotoxic effect
on
its own. Also,
it showed dose-dependency and time-dependency for β-cyclodextrin
–curcumin on T47D cell line. Expression of telomerase gene in
cells effectively was reduced as the concentration of β-cyclodextrin
–curcumin complex was increased.
The
results show that β-cyclodextrin -curcumin complex have
cytotoxic effect on T47D cell line through down regulation of
telomerase expression and induction apoptosis by enhancing
curcumin uptake by cells. So,
β-cyclodextrin could be good carrier for these kinds of
hydrophobic agents.
Key words:
Anti cancer drug, target therapy, telomerase, breast cancer,
drug delivery
|
|
|
|
Introduction |
|
|
|
Breast cancer is the second cause of
cancer death in women (Tian et al., 2010).
Telomerase, ribonucleoprotein enzyme maintained telomere length
and inhibit cellular aging. In about 85 -90% of human cancer
cells, including breast cancer, telomerase
is overexpressed (Tarkanyi and
Aradi
2008; Kirkpatrick et al., 2003; Herbert et al., 2001).
Therefore,
inhibition of telomerase activity is
an
effective target for
the
treatment of breast cancer (Tian et al., 2010).
It is investigated that curcumin(diferulo-ylmethane)
down regulate catalytic subunit of telomerase (hTERT)
(Nicole, 2008; Hsina et al., 2010).
Curcumin, a polyphenol compound
is derived from the
herb of Curcuma longa (known as turmeric). It has various
range of applications in medicine traditionally (Ajaikumar et
al., 2008; Aggarwal et al., 2007; Sharma et al., 2005).
Despite all of therapeutic application of curcumin, its utility
is limited due to poor water solubility and bioavailability and
high decomposition rate (Anand et al., 2008).
For improving its stability and solubility,
it is
a
good way to conjugate or encapsulate curcumin by some carrier
such as cyclodextrin (Vivek et al., 2009). Commonly used
cyclodextrins are α-cyclodextrin, β-cyclodextrin and γ-cyclodextrin
(Vivek et al., 2009). The difference between
the
three types is
their inner cavity. The inner cavity of α-cyclodextrin is very
small for curcumin loading and inner cavity of γ-cyclodextrin is
too large for curcumin loading, but inner cavity of β-cyclo-dextrin
is appropriate for curcumin loading (Vivek et al., 2009). In
other nanoparticle, encapsulation technique
such as poly lactic-co-glycolic
acid (PLGA),
only 5-10% of drug loading is possible but in cyclodextrin more
than 30% of drug loading is possible (Murali et al., 2010).
Although anti telomerase effect of curcumin has been studied
previously in other cancer cell line (Hsina et al., 2010; Cuish
et al., 2006; Jurenka et al., 2009). And preparation of β-
cyclodextrin-curcumin to improve curcumin stability and
solubility has been studied too (Murali et al., 2010).
Therefore, the main
aim of
the
current work was to study the inhibitory effect of β
cyclodextrin- curcumin complex on telomerase gene expression in
T47D breast cancer cell line.
|
|
|
|
Materials And Methods |
|
|
|
Cell culture and cell line
T47D cell line (breast cancer
epithelial like cell line), prepared from, Pasteur Institute cell
bank of Iran, code:C203.this cell line were cultured in RPMI1640 (Gibco,
Invitrogen,UK) supplemented with 10% heat-inactivated fetal bovine
serum (FBS) (Gibco, Invitrogen, UK), 2 mg/ml sodium bicarbonate,0.05
mg/ml penicillin G (Serva co, Germany), 0.08 mg/ml streptomycin
(Merck co, Germany) and incubated in 37°C with humidified air
containing 5% CO2.
Preparation of β-cyclodextrin-curcumin
complex
β-Cyclodextrin-curcumin complex were
prepared according
the
method of Murali et al.
(2010).
40 mg of β-cyclodextrin was dissolved in 8
mL deionized water;
and 12 mg of curcumin was dissolved in 500 µL acetone. These two
solutions
were
mixed together
and
were
placed
on
the
stirrer at 400 rpm for 24 h without a cap to evaporate the acetone.
Then,
it was
centrifuged at 1000 rpm for 5 min and a supernatant were collected
by freeze drying.
Determination of curcumin loading
1 mg of β-cyclodextrin-curcumin
complex was dissolved in 50
mL dimethylsulfoxide (DMSO). Then, solution was
placed
on shaker for 24 h at room temperature. Centrifuged at
14,000
rpm and supernatant was collected for the estimations. A standard
curve of curcumin concentration in DMSO was drowned by absorbance
rate of curcumin via UV-vis spectrophotometer.
In vitro
cytotoxicity (MTT assay)
Cells in the exponential phase of
growth were exposed to β-cyclodextrin-curcumin complex. Cytotoxic
effect of β-cyclodextrin-curcumin complex was studied by 24, 48 and
72 h MTT assay (3, 4,
5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide).
2 × 103 cell/well was plated in a 96-well plate (Coastar
from Corning, NY) and after 24 h incubation,
cells were treated with different concentrations (5-100 μM) of β-cyclodextrin-curcumin
in the quadruplicate manner. Also,
cyclodextrin in PBS or DMSO was used as the control. After these
different exposure duration, medium was removed and then feeding of
the cells with 200 μL of fresh medium. Cells were
kept standing
for 24 h, then 50 μL of 2 mg/ml MTT (Sigma co, Germany)
was
dissolved in PBS and was added to each well and plate was covered
with aluminum foil and incubated for 4 h. In the next step, wells’ content was
removed and 200 μL pure DMSO and 25 μL Sorensen’s glycine buffer was
added to wells.
Finally,
amount of formazan was determined measuring the absorbance at 570 nm
using an ELISA plate reader (with a reference wavelength of 630 nm).
Cell treatment
After determination of IC50,
2.5 × 105 cells in 25 cm2 flasks were treated
with 3 concentrations lower than IC50 of 24h β-Cyclodextrin-curcumin
complex (5, 10 and 15 μM). Then, culture flasks were incubated for
24 h. For control cells, 1% DMSO without β-Cyclodextrin-curcumin
complex was added to flask of control cells.
Then, culture
flasks were incubated in 37°C containing 5% CO2 with
humidified atmosphere incubator for 24 h exposure duration.
Real-time PCR (qRT-PCR) assay
In ribonucleic acid (RNA) extraction,
the TRIzol (Cinnagene, Iran) was used. To prevent genomic
deoxyribonucleic acid (DNA) contamination, total RNA sample were
treated by DNase-I recombinant, RNase-free (Roche) as recommended
protocol by manufacture. Then cDNA synthesized according to kit
(First Strand cDNA Synthesis Kit fermentase, K1622).
For real-time PCR,
we used hTERT primers (Genbank accession: NM_198255, bp 2165-2362)
and beta actin primers (Genbank accession: NM_001101, bp 787-917).
For hTERT, a 198 bp amplicon and for beta actin a 131 bp amplicon
were generated in a 25
μl reaction mixture that contained: 5 pmole of the forward and
reverse PCR primers of hTERT (5’CCGCCTGAGCT-GTACTTTGT3’, 5’
CAGGTGAGCCACGAACTGT3’ respectively) or for beta actin
(5’TCCCTGGAGAAGAGCTACG3’, 5’GTAGTTT-CGTGGATGCCACA3’ respectively),
2X PCR Master Mix Syber Green I and 2μl of the cDNA was used (Table
1).
Each
DNA sample was divided so that hTERT and beta actin could be
amplified,in parallel, and in duplicated from equal amounts of
starting cDNA separately. 25 μl reactions contained the
following final concentrations: 1X of MaximaTM SYBR Green/ROX qPCR
Master Mix (including MaximaTM Hot start
Taq Polymerase, MaximaTM SYBR Green qPCR Buffer, SYBR Green I and
ROX Passive reference dye), 5pmole of each primer and 2μl of the
cDNA. Negative controls were prepared each time, consisting of 2
μl ddH2O instead of the cDNA template.
The
sample tubes were placed into the (Rotor-Gene 6000, Corbet) with the
following settings as manufacture protocol (Table 2).
|
|
|
|
Results |
|
|
|
Determination of curcumin loading
Standard curve of curcumin
concentration in DMSO was prepared via UV-Vis
spectrophotometer at 450 nm (Figure 1). 1 mg of β-Cyclodextrin-curcumin
complex contained 276.44
µg curcumin.
Table 1.
Real-time PCR (qRT-PCR) assay.
|
Oligonucleotide |
Location |
Sequence |
PCR product size (pb) |
|
hTERT
Forward primer
Reverse primer |
2165F
2362R |
5’CCGCCTGAGCTGTACTTTGT3’
5’ CAGGTGAGCCACGAACTGT3’ |
198
|
|
|
|
|
|
|
Beta-actin
Forward primer
Reverse primer |
787F
917R |
5’TCCCTGGAGAAGAGCTACG3’
5’GTAGTTTCGTGGATGCCACA3’ |
131 |
Table 2.
The PCR program for hTERT and beta actin.
|
Step |
Temprature
(°C) |
Time |
Number of cycles |
|
Holding |
95 |
10 min |
1 |
|
Denaturation |
95 |
15 sec |
-
40
- |
|
Annealing |
60 |
30 sec |
|
Extension |
72 |
30 sec |
|
Melting |
70-95 |
- |
1 |
MTT assay
T47D cell line was
exposed to
varying concentration of β-cyclodextrin-curcumin complex
(5-100 μM) for 24, 48 and 72 h. And
cell viability was demonstrated by
MTT assay. β-Cyclodextrin-curcumin complex had cytotoxic
effect on T47D cell line. IC50 of 18 µMfor 24 h,
13 µM for 48 h and 11 µM for 72 h, were achieved and graph
was drown by SPSS 16 (Figure 2). Results show
that almost at wells with concentrations 60 -100 µM in relation to
other wells, cells were
dead
completely.
Because our achieved IC50s are not near to each
other and showed more change, we can tell that
the
effect of β-cyclodextrin-curcumin
complex on T47D cell line was dose-depending and
time-depending.
Cell treatment
At treatment step for
the
study
of
telomerase gene expression, we investigated telomerase gene
expression at T47D breast cancer cell line after 24 h of β-cyclodextrin-curcumin
complex exposure (Figure 3).
Results for real-time PCR
hTERT mRNA levels were measured via real-time PCR. The level
of hTERT mRNA was normalized to mRNA levels of the uniformly
expressed housekeeping gene, beta actin, within each sample
(Figure 4). The differences of 2–ΔΔCt values were
calculated. With increasing amount of 2-
ΔΔCt, the expression of mRNA levels decreases (Table
3). Data analysis of real-time PCR showed that with
increasing concentration of β-cyclodextrin-curcumin complex,
a decreasing trend was appeared in mRNA levels of hTERT
(Figure 5). Each sample was repeated 4 times.
|
|
|
|
Discussion |
|
|
|
In this study,
we used β-cyclodextrin-curcumin complex instead of free curcumin,
because β-cyclodextrin enhance curcumin delivery through higher
uptake by cells (Murali et al., 2010; Vivek et al., 2010). Our study
demonstrated that β-cyclodextrin-curcumin complex could inhibit
efficiently telomerase expression in T47D breast cancer cell line.
Although, curcumin has shown a wide
range of pharmacological activities, its anticancer properties have
attracted a great interest. The anticancer activity of curcumin has
been the subject of hundreds of papers and has been reviewed in
several recent articles (Ajaikumar et al., 2008; Aggarwal et al.,
2007; Sharma et al., 2005; Cui et al., 2005). Despite the biological
effects of curcumin, its use is limited due to: poor
bioavailability, slow dissolution rate, low water solubility, high
decomposition rate in alkaline condition, photodegradation in
organic solvents, and instability in the gastrointestinal tract (Rajeswari
et al., 2005). For enhancing drug delivery, cyclodextrin has been
used in some articles. Some examples are described.
Rajeswari et al. (2005) in their study showed cyclodextrin
enhance the bioavailability of insoluble drugs by increasing the
drug solubility, dissolution, and/or drug permeability. Cyclodextrin
increase the permeability of insoluble, hydrophobic drugs by making
the drug available at the surface of the biological barrier, skin,
mucosa, or the eye cornea, from where it partitions into the
membrane without disrupting the lipid layers of the barrier.
Vivek et al. (2010) and in their study showed cyclodextrin-complexed
curcumin had superior attributes compared with free curcumin for
cellular uptake and for antiproliferative and antiinflammatory
activities.
Parallel with our study, to evaluate cytotoxic effect of curcumin
and β-cyclodextrin-curcumin complex on the proliferation of prostate
cancer cells,
Murali et al.
(2010)
treated DU145 and C4-2 cells with (5-40 µM) curcumin and β-Cyclodextrin-curcumin
complex, then detected the cell viability by the MTS method. β-Cyclodextrin-curcumin
complex inhibited the growth of prostate cells higher than free
curcumin.
According to our study,
to evaluate cytotoxic effect of β-cyclodextrin-curcumin complex on
proliferation of T47D breast cancer cell line, we treated this cell
line with different concentration (5-100µM) of β-cyclodextrin-curcumin
complex for three times 24, 48 and 72 h by MTT assay. For this
purpose,
we prepared β-cyclodextrin-curcumin complex according
to the
method of (Murali et al., 2010), the proportion of curcumin to
cyclodextrin was 30%. In other words,
approximately about 30% of curcumin loaded into cyclodextrin.
Because Murali et al.
(2010) in their study showed that in this
proportion, curcumin effectively was uptake from cells,
we investigated that curcumin-cyclodextrin had anti cancer effect
onT47D breast cancer cell line.
It should be noted that
the
effect of β-cyclodextrin-curcumin
complex in T47D cell line has never been done so far, and inhibitory
effect of β-cyclodextrin-curcumin complex on hTERT expression gene
has never been done so far. So there isn't anything for comparison.
The in vitro effect of β-cyclodextrin-curcumin complex on
T47D cell line requires further investigation. But studies in other
cancer cell lines have shown that β-cyclodextrin-curcumin complex
were more effective than free curcumin in the cancer cell lines.


Table 3. Measurement of hTERT mRNA
Level in samples with ΔCt.
|
Concentration of
β-cyclodextrin-curcumin complex |
5
µM |
10
µM |
15
µM |
Control DMSO |
Control cyclodextrin |
Control cell |
|
Samples Ct |
23.48 |
32.76 |
33.39 |
22.51 |
23.16 |
22.72 |
|
Internal Controls Ct |
22.53 |
23.55 |
23.56 |
23.12 |
23.54 |
23.52 |
|
(ΔCt) |
0.95 |
9.21 |
9.83 |
0.61 |
0.38 |
0.79 |
|
2- ΔΔCt |
0.299 |
0.001 |
0.0006 |
0.8813 |
0.7513 |
1 |

|
|
|
|
Conclusion |
|
|
|
Our results show that β-cyclodextrin-curcumin complex
had inhibitory effect on breast cancer T47D cell line. This
inhibition was dose-dependent and time-dependent too.
Cytotoxic effect of β-cyclodextrin-curcumin complex in the
cells was increased with increasing concentration of β-cyclodextrin-curcumin
complex. Data analysis showed that with increasing
concentration of β-Cyclodextrin-curcumin complex, decreasing
trend of telomerase expression was observed. Briefly, as our
data showed that cyclodextrin-curcumin inclusion complex had
inhibitory effect on expression of hTERT mRNA, we can use
this complex as an anti cancer drug in breast cancer
treatment.
Acknowledgements
This study was supported by grants from
Drug Applied Research Center of Tabriz University
of Medical Sciences. We thank thereby Drug Applied Research
Center of Tabriz University of Medical Sciences for funding
this research.
|
|
|
|
References |
|
|
|
Aggarwal BB, Sundaram C, Malani N, Ichikawa H (2007).
Curcumin: the Indian solid gold. Adv. Exp. Med. Biol. 595:
1-75.
Ajaikumar B, Kunnumakkara P, Anand B,
Aggarwal B (2008). Curcumin inhibits proliferation, invasion,
angiogenesis and metastasis of different cancers through interaction
with multiple cell signaling proteins. Cancer Letters, 269: 199-225.
Anand P (2008). Biological activatives of curcumin and its analogues
(Congeners) made by man and Mother Nature. Biochem Pharma. 76:
1590-1611.
Cui SH (2006).Curcumin inhibits telomerase activity in human cancer
cell lines. Int. J. Mol. Med. 18: 227-231.
Cui SX, Qu XJ, Xie YY, Zhou L, Nakata
M, Makuuchi M, Tang W(2006). Curcumin inhibits telomerase activity
in human cancer cell lines. Int. J. Mol. Med. p. 18.
Herbet B, Wright WE, Shaly J
(2001).Telomerase and breast cancer. Breast cancer Res. 3(3):
146-149.
Hsina I, Sheua G, Chena H, Chiua L, Wange W, Chana H, Hsuc CH, Liang
D (2010). N-acetyle cysteine mitigates curcumin-mediated telomerase
inhibition through rescuing of SP1 reduction in A549 cells. Mut.
Res. 688: 72-77.
Jurenka J (2009). Anti-inflammatory properties of curcumin, a major
constituent of curcuma longa: A review of preclinical and clinical
research. Alter. Med. Rev. 14(2): 141-152.
Kirkpatrick KL, Ogunkolade W, Elkak
AE, Bustin S, Jenkins P, Ghilchick M, Newbold RF, Mokbel K (2003).
hTERT expression in human breast cancer and noncancerous breast
tissue: correlation with tumour stage and c-Myc expression.
Breast Cancer Res. Treatment, 77: 277-284.
Murali MY, Jaggi S, Chauhan C (2010). β -Cyclodextrin-curcumin
self-assembly enhances curcumin delivery in prostate cancer cells.
Colloids and Surfaces B: Biointerfaces, 79: 113-125.
Nicole MB (2008). Targeting telomerase
and telomeres with small molecule anti cancer compounds. MMG
445 Basic Biotechnol. J. 4: 72-79.
Rajeswari C, Alka A, Javed A, Khar RK
(2005). Cyclodextrins in Drug Delivery:
AAPS Pharm. Sci. Tech. 6(2): p. 43.
Sharma RA, Gescher AJ, Steward WP (2005). Curcumin: the story so far.
Eur. J. Cancer, 41(13): 1955-1968.
Tarkanyi I, Aradi J (2008).
Pharmacological intervention strategies for affecting telomerase
activity. Future prospects to treat cancer and degenerative
disease. Biochimie. 90: 156-172.
Tian N, Gaines WJ, Benjamin ZF (2010).
Female breast cancer mortality clusters
within racial groups in the United States. Health Place, 16:
209-218.
Vivek RY, Sarasija S, Kshama D, Seema Y (2009). Effect of
Cyclodextrin Complexation of Curcumin on its Solubility and
Antiangiogenic and Anti-inflammatory Activity in Rat Colitis Model.
AAPS. Pharm. Sci. Tech. 10(3).
Vivek RY ,Sahdeo P, Ramaswamy K, Jayaraj R, Madan MC, Lauri V,
Jaakko P, Bharat BA (2010). Cyclodextrin-complexed curcumin exhibits
anti-inflammatory and antiproliferative activities superior to those
of curcumin through highercellular uptake. Biochem. Pharmacol. 80:
1021-1032.
|
|